Salivary alpha amylase (AMY1A) (NM_004038) Human Untagged Clone

CAT#: SC117623

AMY1A (untagged)-Human amylase, alpha 1A (salivary) (AMY1A), transcript variant 1


  "NM_004038" in other vectors (4)

Reconstitution Protocol

USD 477.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


AMY1A Antibody - middle region
    • 100 ul

USD 539.00

Other products for "Salivary alpha amylase"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Salivary alpha amylase
Synonyms AMY1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_004038, the custom clone sequence may differ by one or more nucleotides


ATGAAGCTCTTTTGGTTGCTTTTCACCATTGGGTTCTGCTGGGCTCAGTATTCCTCAAATACACAACAAG
GACGAACATCTATTGTTCATCTGTTTGAATGGCGATGGGTTGATATTGCTCTTGAATGTGAGCGATATTT
AGCTCCCAAGGGATTTGGAGGGGTTCAGGTCTCTCCACCAAATGAAAATGTTGCCATTCACAACCCTTTC
AGACCTTGGTGGGAAAGATACCAACCAGTTAGCTATAAATTATGCACAAGATCTGGAAATGAAGATGAAT
TTAGAAACATGGTGACTAGATGCAACAATGTTGGGGTTCGTATTTATGTGGATGCTGTAATTAATCATAT
GTGTGGTAATGCTGTGAGTGCAGGAACAAGCAGTACCTGTGGAAGTTACTTCAACCCTGGAAGTAGGGAC
TTTCCAGCAGTCCCATATTCTGGATGGGATTTTAATGATGGTAAATGTAAAACTGGAAGTGGAGATATCG
AGAACTATAATGATGCTACTCAGGTCAGAGATTGTCGTCTGTCTGGTCTTCTCGATCTTGCACTGGGGAA
GGATTATGTGCGTTCTAAGATTGCCGAATATATGAACCATCTCATTGACATTGGTGTTGCAGGGTTCAGA
ATTGATGCTTCCAAGCACATGTGGCCTGGAGACATAAAGGCAATTTTGGACAAACTGCATAATCTAAACA
GTAACTGGTTCCCGGAAGGTAGTAAACCTTTCATTTACCAGGAGGTAATTGATCTGGGTGGTGAGCCAAT
TAAAAGCAGTGACTACTTTGGTAATGGCCGGGTGACAGAATTCAAGTATGGTGCAAAACTCGGCACAGTT
ATTCGCAAGTGGAATGGAGAGAAGATGTCTTACTTAAAGAACTGGGGAGAAGGTTGGGGTTTCATGCCTT
CTGACAGAGCGCTTGTCTTTGTGGATAACCATGACAATCAACGAGGACATGGCGCTGGAGGAGCCTCTAT
ACTTACCTTCTGGGATGCTAGGCTGTACAAAATGGCAGTTGGATTTATGCTTGCTCATCCTTATGGATTT
ACACGAGTAATGTCAAGCTACCGTTGGCCAAGATATTTTGAAAATGGAAAAGATGTTAATGATTGGGTTG
GGCCACCAAATGATAATGGAGTAACTAAAGAAGTTACTATTAATCCAGACACTACTTGTGGCAATGACTG
GGTCTGTGAACATCGATGGCGCCAAATAAGGAACATGGTTAATTTCCGCAATGTAGTGGATGGCCAGCCT
TTTACAAACTGGTATGATAATGGGAGCAACCAAGTGGCTTTTGGGAGAGGAAACAGAGGATTCATTGTTT
TCAACAATGATGACTGGACATTTTCTTTAACTTTGCAAACTGGTCTTCCTGCTGGCACATACTGTGATGT
CATTTCTGGAGATAAAATTAATGGCAACTGCACAGGCATTAAAATCTACGTTTCTGATGATGGCAAAGCT
CATTTTTCTATTAGTAACTCTGCTGAAGATCCATTTATTGCAATTCATGCTGAATCTAAATTGTAA


Restriction Sites Please inquire     
ACCN NM_004038
Insert Size 1860 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004038.3, NP_004029.2
RefSeq Size 1862 bp
RefSeq ORF 1536 bp
Locus ID 276
UniProt ID P04745
Cytogenetics 1p21.1
Domains alpha-amylase, Aamy_C, Aamy
Protein Families ES Cell Differentiation/IPS, Secreted Protein
Protein Pathways Metabolic pathways, Starch and sucrose metabolism
Gene Summary Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, and thus catalyze the first step in digestion of dietary starch and glycogen. The human genome has a cluster of several amylase genes that are expressed at high levels in either salivary gland or pancreas. This gene encodes an amylase isoenzyme produced by the salivary gland. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.