Ido1 (NM_001293690) Mouse Untagged Clone

CAT#: MC226989

Ido1 (untagged) - Mouse indoleamine 2,3-dioxygenase 1 (Ido1), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ido1
• Synonyms: Ido; Indo
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226989 representing NM_001293690
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGTATGTGTGGAACCGAGGGGATGACGATGTTCGAAAGGTGCTGCCCCGCAATATTGCTGTTCCCT
  ACTGCGAGCTCTCAGAGAAGTTGGGCCTGCCTCCTATTCTGTCTTATGCAGACTGTGTCCTGGCAAACTG
  GAAGAAAAAGGACCCCAATGGGCCCATGACATACGAGAACATGGACATTCTGTTCTCATTTCCTGGTGGG
  GACTGCGACAAGGGCTTCTTCCTCGTCTCTCTATTGGTGGAAATCGCAGCTTCTCCTGCAATCAAAGCAA
  TCCCCACTGTATCCAGTGCAGTAGAGCGTCAAGACCTGAAAGCATTGGAAAAGGCACTGCACGACATAGC
  TACCAGTCTGGAGAAAGCCAAGGAAATTTTTAAGAGGATGCGTGACTTTGTGGACCCAGACACGTTTTTC
  CACGTTCTCCGCATATATCTGTCTGGCTGGAAATGCAGCTCCAAGCTGCCAGAAGGTCTGCTGTATGAGG
  GGGTCTGGGACACCCCAAAAATGTTTTCAGGGGGCAGTGCAGGCCAGAGCAGCATCTTCCAGAGTCTTGA
  TGTCCTTCTGGGAATAAAACACGAGGCTGGCAAAGAATCTCCTGCAGAATTCCTCCAGGAAATGAGAGAG
  TACATGCCTCCAGCCCACCGGAACTTCCTTTTCTTCTTAGAGTCAGCTCCCCCAGTCCGTGAGTTTGTCA
  TTTCAAGACACAATGAAGACTTGACGAAAGCTTATAACGAGTGTGTGAATGGTCTGGTCTCTGTGAGAAA
  GTTCCACCTCGCAATAGTAGATACTTACATTATGAAACCTTCGAAGAAGAAGCCCACTGATGGCGACAAG
  TCGGAAGAGCCCTCAAATGTGGAAAGCAGAGGGACTGGGGGTACGAATCCCATGACTTTCCTAAGGAGTG
  TGAAAGATACAACCGAGAAAGCTCTTCTGAGTTGGCCTTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001293690
• Insert Size: 951 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001293690.1, NP_001280619.1
• RefSeq Size: 1659 bp
• RefSeq ORF: 951 bp
• Locus ID: 15930
• UniProt ID: P28776
• Cytogenetics: 8 A2
• Gene Summary: Catalyzes the first and rate limiting step of the catabolism of the essential amino acid tryptophan along the kynurenine pathway. Involved in the peripheral immune tolerance, contributing to maintain homeostasis by preventing autoimmunity or immunopathology that would result from uncontrolled and overreacting immune responses. Tryptophan shortage inhibits T lymphocytes division and accumulation of tryptophan catabolites induces T-cell apoptosis and differentiation of regulatory T-cells. Acts as a suppressor of anti-tumor immunity (PubMed:25691885). Limits the growth of intracellular pathogens by depriving tryptophan. Protects the fetus from maternal immune rejection (Ref. 3).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) contains an alternate exon in place of the first exon compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.