Casp3 (NM_009810) Mouse Untagged Clone
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Casp3 |
Synonyms | A830040C14Rik; AC-; AC-3; Casp; CASP-3; Caspase-3; CC3; CPP; CPP-32; CPP32; Lice; mld; mldy; SCA-1; Ya; Yama |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208217 representing NM_009810
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGAACAACAAAACCTCAGTGGATTCAAAATCCATTAATAATTTTGAAGTAAAGACCATACATGGGA GCAAGTCAGTGGACTCTGGGATCTATCTGGACAGTAGTTACAAAATGGATTATCCTGAAATGGGCATATG CATAATAATTAATAATAAGAACTTCCATAAGAGCACTGGAATGTCATCTCGCTCTGGTACGGATGTGGAC GCAGCCAACCTCAGAGAGACATTCATGGGCCTGAAATACCAAGTCAGGAATAAAAATGATCTTACTCGTG AAGACATTTTGGAATTAATGGATAGTGTTTCTAAGGAAGATCATAGCAAAAGGAGCAGCTTTGTGTGTGT GATTCTAAGCCATGGTGATGAAGGGGTCATTTATGGGACAAATGGGCCTGTTGAACTGAAAAAGTTGACT AGCTTCTTCAGAGGCGACTACTGCCGGAGTCTGACTGGAAAGCCGAAACTCTTCATCATTCAGGCCTGCC GGGGTACGGAGCTGGACTGTGGCATTGAGACAGACAGTGGGACTGATGAGGAGATGGCTTGCCAGAAGAT ACCGGTGGAGGCTGACTTCCTGTATGCTTACTCTACAGCACCTGGTTACTATTCCTGGAGAAATTCAAAG GACGGGTCGTGGTTCATCCAGTCCCTTTGCAGCATGCTGAAGCTGTACGCGCACAAGCTAGAATTTATGC ACATTCTCACTCGCGTTAACAGGAAGGTGGCAACGGAATTCGAGTCCTTCTCCCTGGACTCCACTTTCCA CGCAAAGAAACAGATCCCGTGTATTGTGTCCATGCTCACGAAAGAACTGTACTTTTATCACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_009810 |
Insert Size | 834 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC038825, AAH38825 |
RefSeq Size | 1517 bp |
RefSeq ORF | 834 bp |
Locus ID | 12367 |
UniProt ID | P70677 |
Cytogenetics | 8 26.39 cM |
Gene Summary | This gene encodes a protein that belongs to a highly conserved family of cysteinyl aspartate-specific proteases that function as essential regulators of programmed cell death through apoptosis. Members of this family contain an N-terminal pro-domain and require cleavage at specific aspartate residues to become mature. The protein encoded by this gene belongs to a subgroup of cysteinyl aspartate-specific proteases that are activated by initiator caspases and that perform the proteolytic cleavage of apoptotic target proteins. Mice defective for this gene exhibit a variety of phenotypes including reduced neuronal apoptosis resulting in hyperplasias, hearing loss, attenuated osteogenic differentiation of bone marrow stromal stem cells, and pre- and post-natal lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203736 | Casp3 (tGFP-tagged) - Mouse caspase 3 (Casp3) |
USD 650.00 |
|
MR203736 | Casp3 (Myc-DDK-tagged) - Mouse caspase 3 (Casp3) |
USD 450.00 |
|
MR203736L3 | Lenti ORF clone of Casp3 (Myc-DDK-tagged) - Mouse caspase 3 (Casp3) |
USD 750.00 |
|
MR203736L4 | Lenti ORF clone of Casp3 (mGFP-tagged) - Mouse caspase 3 (Casp3) |
USD 750.00 |
{0} Product Review(s)
Be the first one to submit a review