Cdkn2c (NM_007671) Mouse Untagged Clone
CAT#: MC204135
Cdkn2c (untagged) - Mouse cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) (Cdkn2c), (10ug)
"NM_007671" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cdkn2c |
Synonyms | C77269; INK; INK4c; p1; p18; p18-INK4c; p18-INK6; p18IN; p18INK4c |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC027026
CCCCTCTCCAATGGGCTCACTTTTGCTGAATAATCACGTGTGAATCGAGGGGCGGGCTTTTGGCAGGCCG ACCTTACTAGTATTTACTACCAAGCTCTACTCCAGATTAACCATCCCAGTCCTTCTGTCAGCCTCCGATG CCATCATGCAGCCTGATTAGGAGCAAAGGAAAGGGGAAAAAGAGAAGCAACTAATCGTCTTTTCCCGATC GTCAGGACCCTAAAGAATGGCCGAGCCTTGGGGGAACGAGTTGGCGTCCGCAGCTGCCAGGGGGGACCTA GAGCAACTTACTAGTTTGTTGCAAAATAATGTAAACGTCAACGCTCAAAATGGATTTGGGAGAACTGCGC TGCAGGTTATGAAACTTGGAAATCCGGAGATTGCCAGGAGGCTTCTCCTCAGAGGTGCTAATCCCAATTT GAAAGATGGAACTGGTTTTGCTGTCATTCATGATGCTGCCAGAGCAGGTTTCCTGGACACTGTACAGGCT TTGCTGGAGTTCCAGGCTGATGTTAACATTGAAGATAATGAAGGGAACCTGCCCTTGCACTTGGCTGCCA AAGAAGGCCACCTCCCTGTGGTGGAGTTCCTTATGAAGCACACAGCCTGCAATGTGGGGCATCGGAACCA TAAGGGGGACACCGCCTTCGACTTGGCCAGGTTCTATGGAAGAAATGAGGTCATTAGCCTGATGGAGGCA AATGGGGTTGGGGGAGCCACAAGCCTGCAGTGAATGTGTAGAGGTCTCTCTCACTGACCTCACACTGTCC GTTAGTTGGTTGGCTGTCCGTTTCACTATCACTTATTAAAATATAGGGTTTCCTTTCGCTTTGTTTTCAT ATTTTAAGCAGCCAAATCCTTCAAAACTGCCTAAGTGGAAATCTTACTACAAGTTTATGAAATATTTAAA CTTCTTTTTCACTGTCAAAATTCTGATTTCTAACATGTAATAGCTATTCCTTTTTTTCTGGATATTTTAT CTTTGATTTTTTTTTTCTTTGCTTACCCTTTTTCATTCTCAGTGTCTGACTTGGAGACTTTGTTTTAAAA ATTATTTGTCCTGATGCATCTTTTGCCTAATTAAAACACATTTTTCCAGAAGAGGAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_007671 |
Insert Size | 507 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC027026, AAH27026 |
RefSeq Size | 1119 bp |
RefSeq ORF | 507 bp |
Locus ID | 12580 |
UniProt ID | Q60772 |
Cytogenetics | 4 51.32 cM |
Gene Summary | The protein encoded by this gene is a member of the INK4 family of cyclin-dependent kinase (cdk) inhibitors, and contains five ankyrin repeats. This protein interacts with both Cdk4 and Cdk6 to inhibit their kinase activities, and prevent their interactions with D-type cyclins, thereby negatively regulating cell division. This gene is differentially expressed in a variety of tissues, and is cell cycle regulated. Deletion of this gene can lead to tumor growth. Maximal expression is observed at the G2/M phase. Alternative splicing and promoter usage results in multiple transript variants. [provided by RefSeq, Aug 2014] Transcript Variant: This variant (2, also known as p18(S)) differs in the 5' UTR and represents use of an alternate promoter, compared to variant 1. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201381 | Cdkn2c (tGFP-tagged) - Mouse cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) (Cdkn2c) |
USD 500.00 |
|
MR201381 | Cdkn2c (Myc-DDK-tagged) - Mouse cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) (Cdkn2c) |
USD 300.00 |
|
MR201381L3 | Lenti ORF clone of Cdkn2c (Myc-DDK-tagged) - Mouse cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) (Cdkn2c) |
USD 600.00 |
|
MR201381L4 | Lenti ORF clone of Cdkn2c (mGFP-tagged) - Mouse cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) (Cdkn2c) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review