AMHR2 (NM_020547) Human 3' UTR Clone

CAT#: SC200131

3' UTR clone of anti-Mullerian hormone receptor type II (AMHR2) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: AMHR2
• Synonyms: AMHR; MISR2; MISRII; MRII
• ACCN: NM_020547
• Insert Size: 229 bp
• Sequence Data:
  Insert Sequence

  >SC200131 3’UTR clone of NM_020547
  The sequence shown below is from the reference sequence of NM_020547. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  CAGCCTGCCTGTACCCTTTCTCCTGTGTAAATATGCAGTTTATGTGTCATCAATGTACATGCCAACATA
  AATATGGCGATTGTATAGCTGTCTTGTCTGCCTCATCACTGCATTTCCCACCTGCCGAATCCTTGGATT
  CTTCTGCGGGCATCCAGTCCACATCAGTTCTGACCAGTGACTTGGGGTAGGTGTGCACAGGAAAGAGAA
  TAAAGTCAGCTTTCCTGATGCA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_020547.3
• Summary: This gene encodes the receptor for the anti-Mullerian hormone (AMH) which, in addition to testosterone, results in male sex differentiation. AMH and testosterone are produced in the testes by different cells and have different effects. Testosterone promotes the development of male genitalia while the binding of AMH to the encoded receptor prevents the development of the mullerian ducts into uterus and Fallopian tubes. Mutations in this gene are associated with persistent Mullerian duct syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2009]
• Locus ID: 269
• MW: 8.4