Beclin 1 (BECN1) (NM_003766) Human 3' UTR Clone

CAT#: SC208275

1 star1 star1 star1 star1 star Reviews (1)

3' UTR clone of beclin 1 autophagy related (BECN1) for miRNA target validation


Reconstitution Protocol

USD 683.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "Beclin 1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol Beclin 1
Synonyms ATG6; beclin1; VPS30
ACCN NM_003766
Insert Size 661 bp
Sequence Data
>SC208275 3' UTR clone of NM_003766
The sequence shown below is from the reference sequence of NM_003766. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTGCTTGGGTGTCCTCACAATTTTATAACAAATGACTTTTTTCCTTAGGGGGAGGTTTGCCTTAAAGGCT
TTTAATTTTGTTTTGTTTGCAAACATGTTTTAAATTAAATTCGGGTAATATTAAACAGTACATGTTTACA
ATACCAAAAAAGAAAAAATCCACAAAAGCCACTTTATTTTAAAATATCATGTGACAGATACTTTCCAGAG
CTACAACATGCCATCTATAGTTGCCAGCCCTGGTCAGTTTTGATTCTTAACCCCATGGACTCCTTTCCCT
TTCTTCTCTGAAAAAAACTAATTTAAATTTGCTTTTCTTTTTTTTAACTGAGTTGAATTGAGATTGATGT
GTTTTCACTGGATTTTTATCTCTCTCAACTTCCTGCACTTAACAATATGAAATAGAAACTTTTGTCTTTA
CTGAGATGAGGATATGTTTGAGATGCACAGTTGGATAATGTGGGAAAATGACATCTAAGCTTTACCTGGT
CACCATGTGATGTGATCAGATGCTTGAAATTTAACACTTTTCACTTGGTTCTTATACTGAATGCCGACTC
TGCTCTGTGTTAGAGATATGAAATGGTGTTTGATACTGTTTGAGACATTATGGAGAGATTTAATTATTTG
TAATAAAAGATTTGCTGCAGTCTGAAAACTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_003766.3
Summary This gene encodes a protein that regulates autophagy, a catabolic process of degradation induced by starvation. The encoded protein is a component of the phosphatidylinositol-3-kinase (PI3K) complex which mediates vesicle-trafficking processes. This protein is thought to play a role in multiple cellular processes, including tumorigenesis, neurodegeneration and apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Locus ID 8678

Documents

{0} Product Review(s)

1 Product Review(s) 1 star1 star1 star1 star1 star Submit review

1 star1 star1 star1 star1 star

I used for Gene expression and microRNA signaling studies. The study is already published.

ANJAN P. on 03/24/2023

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.