CYP2A7 (NM_030589) Human Untagged Clone

CAT#: SC310385

CYP2A7 (untagged)-Human cytochrome P450, family 2, subfamily A, polypeptide 7 (CYP2A7), transcript variant 2


  "NM_030589" in other vectors (4)

Reconstitution Protocol

SC310385 is the updated version of SC108147.

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit polyclonal anti-CYP2A7 antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CYP2A7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CYP2A7
Synonyms CPA7; CPAD; CYP2A; CYPIIA7; P450-IIA4
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_030589, the custom clone sequence may differ by one or more nucleotides
ATGCTGGCCTCAGGGCTGCTTCTGGTGGCCTTGCTGGCCTGCCTGACTGTGATGGTCTTG
ATGTCTGTCTGGCAGCAGAGGAAGAGCAGGGGGAAGCTGCCTCCGGGACCCACCCCACTG
CCCTTCATTGGAAACTACCTCCAGCTGAACACAGAGCACATATGTGACTCCATCATGAAG
GTGTCCCAAGGCGTGGCGTTCAGCAACGGGGAGCGCGCCAAGCAGCTCCTGCGCTTTGCC
ATCGCCACCCTGAGGGACTTCGGGGTGGGCAAGCGAGGCATCGAGGAGCGCATCCAGGAG
GAGTCGGGCTTCCTCATCGAGGCCATCCGGAGCACGCACGGCGCCAATATCGATCCCACC
TTCTTCCTGAGCCGCACAGTCTCCAATGTCATCAGCTCCATTGTCTTTGGGGACCGCTTT
GACTATGAGGACAAAGAGTTCCTGTCACTGCTGAGCATGATGCTAGGAATCTTCCAGTTC
ACGTCAACCTCCACGGGGCAGCTCTATGAGATGTTCTCTTCGGTGATGAAACACCTGCCA
GGACCACAGCAACAGGCCTTTAAGTTGCTGCAAGGGCTGGAGGACTTCATAGCCAAGAAG
GTGGAGCACAACCAGCGCACGCTGGATCCCAATTCCCCACAGGACTTCATCGACTCCTTT
CTCATCCACATGCAGGAGGAGGAGAAGAACCCCAACACGGAGTTCTACTTGAAGAACCTG
ATGATGAGCACGTTGAACCTCTTCATTGCAGGCACCGAGACGGTCAGCACCACCCTGCGC
TATGGCTTCTTGCTGCTCATGAAGCACCCAGAGGTGGAGGCCAAGGTCCATGAGGAGATT
GACAGAGTGATCGGCAAGAACCGGCAGCCCAAGTTTGAGGACCGGACCAAGATGCCCTAC
ATGGAGGCAGTGATCCACGAGATCCAAAGATTTGGAGACGTGATCCCCATGAGTTTGGCC
CGCAGGGTTAAAAAGGACACCAAGTTTCGGGATTTTTTCCTCCCTAAGGGCACCGAAGTG
TTCCCTATGCTGGGCTCCGTGCTGAGAGACCCCAGCTTCTTCTCCAACCCTCAGGACTTC
AATCCCCAGCATTTCCTGGATGACAAGGGGCAGTTTAAGAAGAGTGATGCTTTTGTGCCC
TTTTCCATCGGAAAGCGGAACTGTTTCGGAGAAGGCCTGGCCAGAATGGAGCTCTTTCTC
TTCTTCACCACCGTCATGCAGAACTTCCGCCTCAAGTCCTCCCAGTCACCTAAGGACATT
GACGTGTCCCCCAAACACGTGGTCTTTGCCACGATCCCACGAAACTACACCATGAGCTTC
CTGCCCCGCTGA
Restriction Sites Please inquire     
ACCN NM_030589
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_030589.2, NP_085079.2
RefSeq Size 2128 bp
RefSeq ORF 1332 bp
Locus ID 1549
UniProt ID P20853
Cytogenetics 19q13.2
Domains p450
Protein Families Druggable Genome, P450, Transmembrane
Protein Pathways Caffeine metabolism, Drug metabolism - cytochrome P450, Drug metabolism - other enzymes, Metabolic pathways, Retinol metabolism
Gene Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum; its substrate has not yet been determined. This gene, which produces two transcript variants, is part of a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2, also known as CYP2A7AS) lacks exon 2 within the coding region and includes 10 nt from intron 1, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. This variant lacks publicly available transcript support but it is supported by data in PubMedID:7864805.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.