CDC23 (BC010944) Human Untagged Clone

CAT#: SC105953

CDC23 (untagged)-Homo sapiens, clone MGC:13585 IMAGE:4281800, complete cds


Reconstitution Protocol

USD 150.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-CDC23 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CDC23"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CDC23
Synonyms anaphase-promoting complex subunit 8; APC8; cell division cycle 23 homolog (S. cerevisiae); cell division cycle protein 23
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for BC010944, the custom clone sequence may differ by one or more nucleotides


ATGGTCCCGGTGGCTGTGACGGCGGCAGTGGCGCCTGTCCTGTCCATAAACAGCGATTTCTCAGATTTGC
GGGAAATTAAAAAGCAACTGCTGCTTATTGCGGGCCTTACCCGGGAGCGGGGCCTACTACACAGTAGCAA
ATGGTCGGCGGAGTTGGCTTTCTCTCTCCCTGCATTGCCTCTGGCCGAGCTGCAACCGCCTCCGCCTATT
ACAGAGGAAGATGCCCAGGATATGGATGCCTATACCCTGGCCAAGGCCTACTTTGACGTTAAAGAGTATG
ATCGGGCAGCACATTTCCTGCATGGCTGCAATAGCAAGAAAGCCTATTTTCTGTATATGTATTCCAGATA
TCTGGTGAGGGCCATTTTAAAATGTCATTCTGCCTTTAGTGAAACATCCATATTTAGAACCAATGGAAAA
GTTAAATCTTTTAAATAG


>OriGene 5' read for BC010944 unedited
NGGGTCACATTGATACACTATTAGGGGCCGGATTCGCCGAGGGAAAATGGCTGCGAGTAC
CTCCATGGTCCCGGTGGCTGTGACGGCGGCAGTGGCGCCTGTCCTGTCCATAAACAGCGA
TTTCTCAGATTTGCGGGAAATTAAAAAGCAACTGCTGCTTATTGCGGGCCTTACCCGGGA
GCGGGGCCTACTACACAGTAGCAAATGGTCGGCGGAGTTGGCTTTCTCTCTCCCTGCATT
GCCTCTGGCCGAGCTGCAACCGCCTCCGCCTATTACAGAGGAAGATGCCCAGGATATGGA
TGCCTATACCCTGGCCAAGGCCTACTTTGACGTTAAAGAGTATGATCGGGCAGCACATTT
CCTGCATGGCTGCAATAGCAAGAAAGCCTATTTTCTGTATATGTATTCCAGATATCTGTC
TGGAGAAAAAAAGAAGGACGATGAAACAGTTGATAGCTTAGGCCCCCTGGAAAAAGGACA
AGTGAAAAATGAGGCGCTTAGAGAATTGAGAGTGGAGCTCAGCAAAAAACACCAAGCTCG
AGAACTTGATGGATTTGGACTTTATCTGTATGGTGTGGTGCTTCGAAAACTGGACTTGGT
TAAAGAGGCCATTGATGTGTTTGTGGAAGCTACTCATGTTTTGCCCTTGCATTGNGGAGC
CTGGTTAGAACTCTGTAACCTGATCACAGACAAAGAGATGCTGAAGTTCCTGTCTTTGCC
AGACACCTGGATGAAAGAAGTTTTTCTGGCTCATATATACACAGAGTTGCAGTTGATAGA
GGAGGCCCTGCAAAGTATCAGAACTCATTGATGTGGGCTTTCTCTAGAGCTCGTATATTG
TTTCCCAAATTGCAGTTGCCTATCACATATCAGAGATATTGACCAAGCCCTCTCCATTTT
TATGAN
Restriction Sites NotI-NotI     
ACCN BC010944
Insert Size 3500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC010944.1, AAH10944.1
RefSeq Size 1088 bp
RefSeq ORF 438 bp
Locus ID 8697
Cytogenetics 5q31.2
Domains APC8
Protein Families Druggable Genome
Protein Pathways Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis
Gene Summary The protein encoded by this gene shares strong similarity with Saccharomyces cerevisiae Cdc23, a protein essential for cell cycle progression through the G2/M transition. This protein is a component of anaphase-promoting complex (APC), which is composed of eight protein subunits and highly conserved in eukaryotic cells. APC catalyzes the formation of cyclin B-ubiquitin conjugate that is responsible for the ubiquitin-mediated proteolysis of B-type cyclins. This protein and 3 other members of the APC complex contain the TPR (tetratricopeptide repeat), a protein domain important for protein-protein interaction. [provided by RefSeq, Jul 2008]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.