TCEB2 (BC013306) Human Untagged Clone
CAT#: SC105940
TCEB2 (untagged)-Homo sapiens, Similar to transcription elongation factor B (SIII), polypeptide 2 (18kD, elongin B), clone MGC:4486 IMAGE:2963043, complete cds
Product Images
Frequently bought together (4)
Other products for "TCEB2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TCEB2 |
Synonyms | ELOB; elongin, 18-kD subunit; elongin B; RNA polymerase II transcription factor SIII p18 subunit; SIII; SIII p18; transcription elongation factor B (SIII), polypeptide 2 (18kD, elongin B); transcription elongation factor B (SIII), polypeptide 2 (18kDa, el |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for BC013306, the custom clone sequence may differ by one or more nucleotides
ATGGACGTGTTCCTCATGATCCGGCGCCACAAGACCACCATCTTCACGGACGCCAAGGAGTCCAGCACGG TGTTCGAACTGAAGCGCATCGTCGAGGGCATCCTCAAGCGGCCTCCTGACGAGCAGCGGCTGTACAAGGA TGACCAACTCTTGGATGATGGCAAGACACTGGGCGAGTGTGGCTTCACCAGTCAAACAGCACGGCCACAG GCCCCAGCCACAGTGGGGCTGGCCTTCCGGGCAGATGACACCTTTGAGGCCCTGTGCATCGAGCCGTTTT CCAGCCCGCCAGAGCTGCCCGATGTGATGAAGCCCCAGGACTCGGGAAGCAGTGCCAATGAACAAGCCGT GCAGTGA >OriGene 5' read for BC013306 unedited
CACCAGGCAGCAGCCGCGATGGACGTGTTCCTCATGATCCGGCGCCACAAGACCACCATC TTCACGGACGCCAAGGAGTCCAGCACGGTGTTCGAACTGAAGCGCATCGTCGAGGGCATC CTCAAGCGGCCTCCTGACGAGCAGCGGCTGTACAAGGATGACCAACTCTTGGATGATGGC AAGACACTGGGCGAGTGTGGCTTCACCAGTCAAACAGCACGGCCACAGGCCCCAGCCACA GTGGGGCTGGCCTTCCGGGCAGATGACACCTTTGAGGCCCTGTGCATCGAGCCGTTTTCC AGCCCGCCAGAGCTGCCCGATGTGATGAAGCCCCAGGACTCGGGAAGCAGTGCCAATGAA CAAGCCGTGCAGTGAGGACCCCCAAGAGGCCCATTTCCCCCAATAAAAGAGATTTGGGAG TCTGNNNAAAAAAAAAAAAANAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAN |
Restriction Sites | NotI-NotI |
ACCN | BC013306 |
Insert Size | 500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC013306.2, AAH13306.1 |
RefSeq Size | 962 bp |
RefSeq ORF | 357 bp |
Locus ID | 6923 |
Cytogenetics | 16p13.3 |
Domains | UBQ |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Pathways in cancer, Renal cell carcinoma, Ubiquitin mediated proteolysis |
Gene Summary | This gene encodes the protein elongin B, which is a subunit of the transcription factor B (SIII) complex. The SIII complex is composed of elongins A/A2, B and C. It activates elongation by RNA polymerase II by suppressing transient pausing of the polymerase at many sites within transcription units. Elongin A functions as the transcriptionally active component of the SIII complex, whereas elongins B and C are regulatory subunits. Elongin A2 is specifically expressed in the testis, and capable of forming a stable complex with elongins B and C. The von Hippel-Lindau tumor suppressor protein binds to elongins B and C, and thereby inhibits transcription elongation. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. Pseudogenes have been identified on chromosomes 11 and 13. [provided by RefSeq, Aug 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.