OriGene Logo
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
Home CRISPR-CAS9 KN202627

PTEN - human gene knockout kit via CRISPR


Specifications  Citations (1)  Validation Data  FAQ
SKU Description Price Availability Manual  
KN202627 PTEN - human gene knockout kit via CRISPR $1200 7 Days * Manual PDF Add to Shopping Cart

* Business Days

SKU Description Donor Vector Price Availability  
KN202627RB PTEN - human gene knockout kit via CRISPR RFP-BSD 1290 7 Days
KN202627LP PTEN - human gene knockout kit via CRISPR Luciferase-Puro 1290 4 Weeks
KN202627BN PTEN - human gene knockout kit via CRISPR mBFP-Neo 1290 7 days
Add to Shopping Cart

Comparing to KN202627, the above kits contain:

  • Identical gRNA vectors
  • Identical LHA & RHA
  • Different donor cassette
Kit Components
KN202627G1, PTEN gRNA vector 1 in pCas-Guide vector, Target Sequence: CTGTCACTCTCTTAGAACGT
KN202627G2, PTEN gRNA vector 2 in pCas-Guide vector, Target Sequence: GCAGCCGCAGAAATGGATAC
KN202627D, donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
Homologous arm and GFP-puro sequences   
GE100003, scramble sequence in pCas-Guide vector

The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data
RefSeq: NM_000314
Synonyms: 10q23del; BZS; CWS1; DEC; GLM2; MHAM; MMAC1; PTEN1; TEP1
Summary: Isoform alpha: Functional kinase, like isoform 1 it antagonizes the PI3K-AKT/PKB signaling pathway. Plays a role in mitochondrial energetic metabolism by promoting COX activity and ATP production, via collaboration with isoform 1 in increasing protein levels of PINK1. [UniProtKB/Swiss-Prot Function]

Learn more about CRISPR?

Diagram-Gene Editing RecombII


Inc 5000 Healthcare Company