OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home CRISPR-CAS9 CAS Vectors GE100023

pCas-Guide-AAVS1

divider

Specifications Citations Validation Data FAQ
Cat. # Product Name Description Price Availability  
GE100023 pCas-Guide-AAVS1 AAVS1 gRNA vector, validated AAVS1 targeting sequence cloned in pCas-Guide vector $360 In Stock Add to Shopping Cart
Features
  • Validated CRISPR vector targeting human AAVS1 site
  • AAVS1 target sequence: GTTAATGTGGCTCTGGTTCT
  • CMV-driven Cas9 and U6-driven AAVS1 gRNA expression
  • Download vector sequence

Applications

  • Targeted transgene insertion via CRISPR when cotransfected with pAAVS1-puro-DNR (after transgene cloned)
  • CRISPR knockin positive control when paired with pAAVS1-RFP-DNR (SKU GE100026)
Images

 

pattern
Inc 5000 Healthcare Company